ID: 1057228873_1057228885

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1057228873 1057228885
Species Human (GRCh38) Human (GRCh38)
Location 9:93306841-93306863 9:93306889-93306911
Sequence CCCCTTTGTCCTCTCTCATCGCA TCAGGGTTCCCGCGGCCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 252} {0: 1, 1: 0, 2: 0, 3: 13, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!