ID: 1057233170_1057233175

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1057233170 1057233175
Species Human (GRCh38) Human (GRCh38)
Location 9:93337493-93337515 9:93337542-93337564
Sequence CCTTTGCTCGGCACTTCTCCTTT GCTTCTCCTTTGCTTTTGCCAGG
Strand - +
Off-target summary {0: 2, 1: 37, 2: 215, 3: 369, 4: 752} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!