ID: 1057245597_1057245619

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1057245597 1057245619
Species Human (GRCh38) Human (GRCh38)
Location 9:93451865-93451887 9:93451906-93451928
Sequence CCGGCCCCGCCGCCCCCCGCCCG CGCCGCCGCCATGGGCGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 82, 3: 826, 4: 3607} {0: 1, 1: 1, 2: 2, 3: 8, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!