ID: 1057245601_1057245619

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1057245601 1057245619
Species Human (GRCh38) Human (GRCh38)
Location 9:93451874-93451896 9:93451906-93451928
Sequence CCGCCCCCCGCCCGCACCCGCGC CGCCGCCGCCATGGGCGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 27, 3: 255, 4: 2138} {0: 1, 1: 1, 2: 2, 3: 8, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!