ID: 1057256309_1057256317

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1057256309 1057256317
Species Human (GRCh38) Human (GRCh38)
Location 9:93550553-93550575 9:93550574-93550596
Sequence CCTTTTGTTTCTGCCCCTCACCA CAGGTACATGGTGCAGTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 389} {0: 1, 1: 0, 2: 0, 3: 20, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!