ID: 1057275688_1057275694

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1057275688 1057275694
Species Human (GRCh38) Human (GRCh38)
Location 9:93674972-93674994 9:93675011-93675033
Sequence CCCGGTCGAAGAAAAGGAAAGGC ACAGCCCAACAGGTAGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 167} {0: 1, 1: 0, 2: 0, 3: 15, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!