ID: 1057307720_1057307732

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1057307720 1057307732
Species Human (GRCh38) Human (GRCh38)
Location 9:93921779-93921801 9:93921810-93921832
Sequence CCAGCCCCGGCAGCCTCTCAGGG AAGGGCAGAGCCCACGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 397} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!