ID: 1057314601_1057314612

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1057314601 1057314612
Species Human (GRCh38) Human (GRCh38)
Location 9:93960377-93960399 9:93960423-93960445
Sequence CCACCGCTCGCCAGCCCCGGCGG AGTCCAGTTACGCGAACCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 493} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!