ID: 1057326973_1057326985

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1057326973 1057326985
Species Human (GRCh38) Human (GRCh38)
Location 9:94074557-94074579 9:94074582-94074604
Sequence CCTCCCACTCCCCACCACCTCTT CTCCTCATACAGGTGGAGTTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 14, 3: 160, 4: 1533} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!