ID: 1057331406_1057331411

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1057331406 1057331411
Species Human (GRCh38) Human (GRCh38)
Location 9:94119138-94119160 9:94119185-94119207
Sequence CCTCGTTGCCGCCTTGCAGTTTG CAGCGCGATTCCGTGGGCGTAGG
Strand - +
Off-target summary No data {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!