ID: 1057337551_1057337561

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1057337551 1057337561
Species Human (GRCh38) Human (GRCh38)
Location 9:94166998-94167020 9:94167048-94167070
Sequence CCGCGGCCAAGTGCAGCCTCCCT TCCGCTGCGGCAGCCGTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!