ID: 1057352665_1057352669

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1057352665 1057352669
Species Human (GRCh38) Human (GRCh38)
Location 9:94313596-94313618 9:94313648-94313670
Sequence CCACCAATGGAATATTATTCAGC CTAAAAACATGGATGAAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 35, 4: 483}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!