ID: 1057361125_1057361132

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1057361125 1057361132
Species Human (GRCh38) Human (GRCh38)
Location 9:94374676-94374698 9:94374702-94374724
Sequence CCCTCGGCGCCGCCGCTGGCGCC GCCTGACCCGCAGGCCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 118, 4: 1694} {0: 2, 1: 0, 2: 1, 3: 13, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!