ID: 1057367129_1057367138

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1057367129 1057367138
Species Human (GRCh38) Human (GRCh38)
Location 9:94433092-94433114 9:94433137-94433159
Sequence CCTTCCTGCAGCCCTTGAGACGG AGCAGCTTGCCGTGCAGGCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 195} {0: 1, 1: 1, 2: 3, 3: 16, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!