ID: 1057379146_1057379155

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1057379146 1057379155
Species Human (GRCh38) Human (GRCh38)
Location 9:94553503-94553525 9:94553550-94553572
Sequence CCTGGGCTGGGTGTGAGTGCCTT TCCAGCTGGCCAGGAATTGCTGG
Strand - +
Off-target summary No data {0: 7, 1: 4, 2: 7, 3: 28, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!