ID: 1057470139_1057470150

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1057470139 1057470150
Species Human (GRCh38) Human (GRCh38)
Location 9:95349712-95349734 9:95349760-95349782
Sequence CCCTGTGAAAGGTCCCCTGTGCC TCTCTGGCCAGAAGCACCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!