ID: 1057481925_1057481933

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1057481925 1057481933
Species Human (GRCh38) Human (GRCh38)
Location 9:95451430-95451452 9:95451457-95451479
Sequence CCCTGATATTTCTGGGCGGGAAC CCGGCTGAGAGGAGAGCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66} {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!