ID: 1057489152_1057489164

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1057489152 1057489164
Species Human (GRCh38) Human (GRCh38)
Location 9:95508378-95508400 9:95508416-95508438
Sequence CCGCCGCCGCGGGGACGGAGGCT CGCGCTGCTGCCGCTGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138} {0: 1, 1: 2, 2: 20, 3: 104, 4: 865}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!