ID: 1057490626_1057490645

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1057490626 1057490645
Species Human (GRCh38) Human (GRCh38)
Location 9:95517003-95517025 9:95517047-95517069
Sequence CCTGCCCGGCGAGCTCCCGCGAG CCCCGCGGCCGTGTTTGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 92} {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!