ID: 1057592328_1057592341

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1057592328 1057592341
Species Human (GRCh38) Human (GRCh38)
Location 9:96383459-96383481 9:96383500-96383522
Sequence CCCCGGGCCCCGCCTCACCCGTA GTTGACAAGCACGATGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 171} {0: 1, 1: 0, 2: 0, 3: 19, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!