ID: 1057597134_1057597136

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1057597134 1057597136
Species Human (GRCh38) Human (GRCh38)
Location 9:96424087-96424109 9:96424112-96424134
Sequence CCTCTCTCCATCTGTGGAAAGGT TCTTCCACAAAACGAGTCCCTGG
Strand - +
Off-target summary No data {0: 5, 1: 294, 2: 809, 3: 1275, 4: 1466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!