ID: 1057613536_1057613540

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1057613536 1057613540
Species Human (GRCh38) Human (GRCh38)
Location 9:96567614-96567636 9:96567651-96567673
Sequence CCTTTTTAAACAACCATTTAAAA GAGAGTAGAAGGATGGTTATCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 102, 4: 968} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!