ID: 1057642220_1057642224

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1057642220 1057642224
Species Human (GRCh38) Human (GRCh38)
Location 9:96835571-96835593 9:96835587-96835609
Sequence CCTAGCTGCTTCAGCTGAAACAG GAAACAGCCATGGGGTCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 342} {0: 1, 1: 0, 2: 2, 3: 16, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!