ID: 1057666508_1057666514

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1057666508 1057666514
Species Human (GRCh38) Human (GRCh38)
Location 9:97050024-97050046 9:97050070-97050092
Sequence CCCTGTCTCTACTAAAAAAACAA GTGCCTGTAGGCCCAGCTATAGG
Strand - +
Off-target summary {0: 157, 1: 67390, 2: 170537, 3: 207161, 4: 162867} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!