ID: 1057682341_1057682346

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1057682341 1057682346
Species Human (GRCh38) Human (GRCh38)
Location 9:97200718-97200740 9:97200747-97200769
Sequence CCACACACTGTCTTGTGAACACC CTGCCTCCCCACATTAACTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!