ID: 1057685810_1057685820

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1057685810 1057685820
Species Human (GRCh38) Human (GRCh38)
Location 9:97233273-97233295 9:97233320-97233342
Sequence CCTTCCTCCACGCACTCACCCAC ACCTATTGTCACAGCAACAAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 77, 4: 906} {0: 1, 1: 0, 2: 2, 3: 33, 4: 628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!