ID: 1057685813_1057685822

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1057685813 1057685822
Species Human (GRCh38) Human (GRCh38)
Location 9:97233280-97233302 9:97233330-97233352
Sequence CCACGCACTCACCCACTGGCTGT ACAGCAACAAGGGAAAAATCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 19, 4: 219} {0: 1, 1: 0, 2: 3, 3: 32, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!