ID: 1057685815_1057685819

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1057685815 1057685819
Species Human (GRCh38) Human (GRCh38)
Location 9:97233292-97233314 9:97233319-97233341
Sequence CCACTGGCTGTCCTGAGCATCAC CACCTATTGTCACAGCAACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 158, 4: 4085}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!