ID: 1057719966_1057719975

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1057719966 1057719975
Species Human (GRCh38) Human (GRCh38)
Location 9:97524251-97524273 9:97524304-97524326
Sequence CCTAACAGAGGAAGAGCTGAGGA CTGATGTGAGTAGGTGCTAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 301} {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!