ID: 1057730125_1057730130

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1057730125 1057730130
Species Human (GRCh38) Human (GRCh38)
Location 9:97601300-97601322 9:97601324-97601346
Sequence CCTGGCACACTGGCCAGAAGACT GGCAGCCACCATGGCAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 202} {0: 1, 1: 0, 2: 2, 3: 29, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!