ID: 1057746080_1057746085

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1057746080 1057746085
Species Human (GRCh38) Human (GRCh38)
Location 9:97752418-97752440 9:97752454-97752476
Sequence CCGCACTGCTGCTCCTGAAACAG TTGAGAGTGAGCAGGGAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 68, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!