ID: 1057763117_1057763119

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1057763117 1057763119
Species Human (GRCh38) Human (GRCh38)
Location 9:97892143-97892165 9:97892158-97892180
Sequence CCATTGAAAGAGCCTCATCCAAC CATCCAACACCAGCCCCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!