ID: 1057772855_1057772859

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1057772855 1057772859
Species Human (GRCh38) Human (GRCh38)
Location 9:97983472-97983494 9:97983499-97983521
Sequence CCCTCGCTGCGCAAGCCGGGACG TCCCCCCTCCGCCCCCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26} {0: 1, 1: 0, 2: 5, 3: 87, 4: 628}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!