ID: 1057802856_1057802868

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1057802856 1057802868
Species Human (GRCh38) Human (GRCh38)
Location 9:98200496-98200518 9:98200536-98200558
Sequence CCTGGAGGCACAATGTGTGGGGA GGGGAGACTGAATACCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 496} {0: 1, 1: 0, 2: 2, 3: 5, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!