ID: 1057817314_1057817319

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1057817314 1057817319
Species Human (GRCh38) Human (GRCh38)
Location 9:98305078-98305100 9:98305116-98305138
Sequence CCTTTACTTTTGAGACTCACTTA AACACAGATCACCCTACTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!