ID: 1057819215_1057819223

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1057819215 1057819223
Species Human (GRCh38) Human (GRCh38)
Location 9:98318453-98318475 9:98318490-98318512
Sequence CCCTGGACCAGACCTTGACAATC GTCCTGTGCAGGGCTGGCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 38, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!