ID: 1057859826_1057859831

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1057859826 1057859831
Species Human (GRCh38) Human (GRCh38)
Location 9:98632166-98632188 9:98632187-98632209
Sequence CCCTTCACAAATGAAAGAAGTAT ATGTCCTAGTGGAAGGGTCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!