ID: 1057869907_1057869922

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1057869907 1057869922
Species Human (GRCh38) Human (GRCh38)
Location 9:98709355-98709377 9:98709401-98709423
Sequence CCTCCAGGCACCAGAGCGCCCGG CCGCGCGCTGGCACACGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 175} {0: 1, 1: 0, 2: 2, 3: 5, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!