ID: 1057872026_1057872033

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1057872026 1057872033
Species Human (GRCh38) Human (GRCh38)
Location 9:98725525-98725547 9:98725561-98725583
Sequence CCTGGGTATCTGAGGACATATTG TAAATACAGCATGGAAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!