ID: 1057872883_1057872896

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1057872883 1057872896
Species Human (GRCh38) Human (GRCh38)
Location 9:98731571-98731593 9:98731606-98731628
Sequence CCATGCCCTGTGTCTCAGCCTTG GCAGGAAATGGGAACCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 581} {0: 1, 1: 0, 2: 2, 3: 37, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!