ID: 1057872885_1057872892

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1057872885 1057872892
Species Human (GRCh38) Human (GRCh38)
Location 9:98731576-98731598 9:98731595-98731617
Sequence CCCTGTGTCTCAGCCTTGGAGAG AGAGGGCTCCAGCAGGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 408} {0: 1, 1: 0, 2: 2, 3: 22, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!