ID: 1057872886_1057872898

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1057872886 1057872898
Species Human (GRCh38) Human (GRCh38)
Location 9:98731577-98731599 9:98731628-98731650
Sequence CCTGTGTCTCAGCCTTGGAGAGG GTCCCTATGCTGATGCGAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 236} {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!