ID: 1057872899_1057872904

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1057872899 1057872904
Species Human (GRCh38) Human (GRCh38)
Location 9:98731630-98731652 9:98731648-98731670
Sequence CCCTATGCTGATGCGAGATGGCT TGGCTCCACTCTGCTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53} {0: 1, 1: 0, 2: 5, 3: 19, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!