ID: 1057872900_1057872909

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1057872900 1057872909
Species Human (GRCh38) Human (GRCh38)
Location 9:98731631-98731653 9:98731664-98731686
Sequence CCTATGCTGATGCGAGATGGCTC GGCAGGGCCCCAAGTTGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65} {0: 1, 1: 0, 2: 2, 3: 5, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!