ID: 1057873307_1057873316

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1057873307 1057873316
Species Human (GRCh38) Human (GRCh38)
Location 9:98734029-98734051 9:98734070-98734092
Sequence CCCTCCTCCCTGACGATCTATAA CCTCCACACATGCCCCCGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 81} {0: 1, 1: 1, 2: 3, 3: 14, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!