ID: 1057875834_1057875840

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1057875834 1057875840
Species Human (GRCh38) Human (GRCh38)
Location 9:98753977-98753999 9:98753994-98754016
Sequence CCCCACTGCCCATCTCTTCCCAG TCCCAGTGTCGTGGTCCAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!