ID: 1057911878_1057911894

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1057911878 1057911894
Species Human (GRCh38) Human (GRCh38)
Location 9:99025906-99025928 9:99025950-99025972
Sequence CCCTGAGGGACAGCCTGGAGTTG GGATGAAAGGGGAGAAGGTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 290} {0: 1, 1: 0, 2: 10, 3: 86, 4: 1078}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!