ID: 1057913029_1057913043

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1057913029 1057913043
Species Human (GRCh38) Human (GRCh38)
Location 9:99035020-99035042 9:99035057-99035079
Sequence CCTGGCAACAGAGGCTTACCTGG AGGGACAAGCTGGCCCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 171} {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!