ID: 1057958558_1057958563

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1057958558 1057958563
Species Human (GRCh38) Human (GRCh38)
Location 9:99432952-99432974 9:99432999-99433021
Sequence CCTTCTGCTTTGGGTGTTTTATT CACCCAACCCAGGAGCCAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!