ID: 1058045501_1058045516

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1058045501 1058045516
Species Human (GRCh38) Human (GRCh38)
Location 9:100352944-100352966 9:100352986-100353008
Sequence CCCCTCCCCCTCCCTGCTGTGCT GCCGCGCGCAACCGGGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 128, 4: 1201} {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!